domingo, 28 de diciembre de 2008

Best Scenes Ever: "Raise up! Get yourself together and drive your funky soul"

Aquí traigo las que sin duda son las mejores escenas de la Historia del Cine. Elegid vosotros vuestra favorita.

El director Sam Raimi supo captar toda la esencia de ese mito cultural llamado Spider-man en estos cortes. Por su complejidad escenica y su gran calidad, me veo sin palabras para poder describirlas pero creo que se explican por si solas.


SPIDERMAN (2002)

EL TIO DEL METRO



SPIDERMAN 2 (2004)

RAINDROPS KEEP FALLING ON MY HEAD



SPIDERMAN 3 (2007)

"Raise up! Get yourself together and drive your funky soul"




Y como regalito, os dejo este maravilloso video:

Spider-Man 3 How It Should Have Ended


miércoles, 24 de diciembre de 2008

Animal Party, take 2

Hoy, por ser el día que es, subiré más de una noticia (mi generosidad no conoce límites).
Quizás surja alguna voz que opine que etiquetar esta serie de acontecimientos en la sección "naturaleza" sea un poco extravagante, pero lo he resuelto así partiendo del hecho de que los protagonistas son todos animales (en el caso de la cabra, que el lector elija quien es el animal).

Enjoy, then, and merry Xmas to all, blah blah blah...




[Vía: antena3.noticias.com]

SENSACIÓN EN YOUTUBE

El gato que sabía hacerse el muerto


Debe ser sencillo entrenar a tu gato para que simule su propia muerte, a juzgar por la cantidad de vídeos que aparecen en YouTube, Metacafé o Digg al teclear las palabras 'cat', 'playing' y 'dead'. Pero este clip promete subir como la espuma, tras acumular más de 150.000 visitas en cinco días.

El video doméstico muestra al animal en primer plano, mirando fijamente al dueño (suponemos), quien le 'dispara' con la mano mientras musita un "bang bang". Y el gato, como en los juegos infantiles de indios y vaqueros, cumple su papel y se desploma convincentemente.



[Vía: publico.es]

Los perros también se indignan ante la injusticia

Un nuevo estudio publicado en PNAS muestra que también los perros son capaces de indignarse


Uno de los perros muestra su disgusto

En el reino animal, la aversión por la justicia era un rasgo que solo se había identificado en primates. Ahora, un nuevo estudio publicado en PNAS muestra que también los perros son capaces de indignarse cuando consideran que no se les está tratando con equidad.

Para llegar a esta conclusión, un grupo de investigadores de la Universidad de Viena realizó un experimento con 43 perros entrenados a los que pidió que levantasen la pata cuando se les ofrecía la mano. Los animales hicieron el gesto en todas las situaciones en que se les pidió que lo realizasen. Sin embargo, algunos empezaron a mostrarse reticentes al juego cuando vieron que sus compañeros eran recompensados por su docilidad y ellos no.

Además de dar la patita con menor frecuencia, los perros que sentían celos por el trato que se daba a sus compañeros mostraron mayores signos de tensión, rascándose, lamiéndose o retirando la mirada de la persona que les ofrecía la mano.

Los perros no llegaron a mostrar el grado de sensibilidad ante la injusticia observado en monos. Éstos son capaces de rechazar la comida que se les ofrece si consideraban que es inferior a la que han visto recibir a sus compañeros. Los perros siempre aceptaron la comida que se les daba aunque fuese peor que la ofrecida a otros.



[Vía: lavanguardia.es]

Sangre de cabra para un feliz vuelo

Nepal Airlines inmola dos cabras y unta su sangre en un Boeing 757 para conjurar una cadena de averías

El sacrificio ritual fue celebrado en un hangar de Katmandú, frente a la plana mayor de la compañía, dispuesta a confirmar que la fe es lo último que se pierde

El pasado domingo, Nepal Airlines restregaba la sangre de dos cabras recién sacrificadas por el morro aerodinámico de su Boeing 757. Con ello, los ingenieros de la compañía, incapaces de arreglar el sistema anticongelante de la nave, apaciguaban a Kal Bhairab, el dios nepalí de la destrucción. Horas después, en un tercer intento, el único Boeing operativo de la aerolínea conseguía surcar los cielos hasta Hong Kong, sin que tuviera que lamentarse destrucción alguna.

Nepal Airlines inmola dos cabras y unta su sangre en un Boeing 757 para conjurar una cadena de averías

El sacrificio ritual fue celebrado en un hangar de Katmandú, frente a la plana mayor de la compañía, dispuesta a confirmar que la fe es lo último que se pierde. Durante días, el equipo de ingenieros había intentado sin éxito reparar uno de los dos únicos aviones nepalíes apto para vuelos internacionales.

En el primer vuelo fallido a Hong Kong viajaron 129 pasajeros, que el miedo redujo a 95 en el segundo intento, que se saldó igualmente con un apresurado regreso a Katmandú. La compañía nepalí de bandera estaba por los suelos -como su segundo Boeing, en un taller de Brunei desde el 1 de agosto- hasta que el jefe de ingenieros, PBS Kansakar, dio con la solución en sueños.

La deidad hindú Kal Bhairab, a la postre emblema de la compañía, le soltó un rapapolvo por no haberle ofrecido ninguna inmolación y reclamó ser resarcida de inmediato. Dicho y hecho, al día siguiente, una cabra blanca y otra negra eran ritualmente degolladas con una jukura, la daga curvada tradicional de los gurjas nepalíes.

La flotilla de Nepal Airlines, tanto internacional como interior, luce en su flanco una imagen protectora del dios Kal Bhairab, como si de un medallón "papá no corras" o de una estampita se tratara. Pero el rostro anaranjado y no precisamente tranquilizador del dios no ha traído demasiada suerte a Nepal

Airlines, que tiene un largo historial de accidentes, atrasos y cancelaciones. Tanto es así, que la industria turística nepalí tuvo que padecer que durante los primeros diez días de agosto la compañía aérea nacional suspendiera todos sus vuelos internacionales. Sus dos viejos Boeing estaban fuera de combate. Huelga decir que el presupuesto de Nepal, que acaba de salir de diez años de guerra civil, no está para muchas alegrías.

De hecho, Nepal Airlines fue hasta hace pocos meses Royal Nepal Airlines, lo que no significa que entonces su servicio fuera precisamente aristocrático. En el 2005 su presidente fue destituido por un desfalco mayúsculo. Ese mismo año, en diciembre, el impopular rey Gyanendra, que todavía le tomaba la medida a la corona, se tomó al pie de la letra el nombre de Royal Nepal Airlines y afanó uno de los dos aviones del Estado para viajar tres semanas por África. De la noche a la mañana, a causa del safari real, un 30% de los vuelos de la compañía fueron cancelados y un 20% sufrieron graves retrasos, con el consiguiente enojo de nacionales y extranjeros, y perjuicio para las arcas públicas.

Por todo ello, cualquier agencia de viajes nepalí recomendará al viajero que tome cualquier otra compañía antes que la aerolínea nacional. Afortunadamente, en los últimos años han proliferado compañías privadas nepalíes con aparatos más modernos para los vuelos interiores, aunque sus nombres sigan teniendo el acento sobrenatural -Yeti Air, Buddha Air- que permite soñar con cabras degolladas y dioses rigurosos.

Cabe añadir que los aeropuertos nepalíes están a la altura de sus aviones de bandera. Imposible comprar un periódico o un regalo. La seguridad es un coladero. Y la autodenominada sala vip de sus aeródromos nacionales parece el cuarto de la fregona. Eso sí, los vuelos a través de Nepal ofrecen vistas impagables del Everest, el Annapurna y otras cumbres legendarias de la cordillera del Himalaya. Si al iracundo Kal Bhairab le da la real gana.


Misma noticia, distinto manera de verla:
[Vía: gizmodo.es]

Nepal Airlines sacrifica dos cabras para arreglar un avión — y funciona

cabras-avion.jpg

Después de una larga serie de problemas técnicos con uno de sus dos Boeing 757, la compañía Nepal Airlines decidió sacrificar dos cabras en frente del avión para arreglarlo. Y adivinad. Sí, funcionó.

Pasó en el aeropuerto de Kathmandu, Nepal. El avión se negaba a arrancar sus motores antes de un vuelo a Hong Kong. En ese punto, altos directivos de la compañía, las líneas aéreas estatales del Nepal, decidieron sacrificar dos cabras a Akash Bhairab, que al parecer es el dios hindú que protege los cielos.

Lo hicieron en frente del avión, que tiene el símbolo del dios pintado en el fuselaje y, según ellos, funcionó. Los problemas, que habían sido la fuente de varios retrasos y cancelaciones de vuelos, desaparecieron y la aeronave completó con éxito el viaje a Hong Kong.

O eso dicen, porque los periódicos locales dijeron que realmente fue un problema técnico.

Nota a mí mismo: cuando vaya a Nepal, tomar el autobús.

lunes, 22 de diciembre de 2008

Bueno, la C.I.A hace lo mismo con el Facebook...

[Vía: yahoo.com]


La inteligencia guatemalteca saca la información... de los periódicos


El jefe del servicio de inteligencia de Guatemala ha confesado que, para hacer sus análisis, sólo se basan en artículos de los periódicos, a pesar de que disponen de un presupuesto anual de 2,2 millones de dólares.

"No hay capacidad para hacer inteligencia, únicamente se analizan las publicaciones en los medios escritos", dijo Manuel Galeano, jefe de la Secretaría de Inteligencia Estratégica, al término de una reunión con los diputados del Congreso el pasado martes por la tarde.

La oficina, adscrita a la Presidencia de la República, cuenta con una plantilla de 125 personas, que de media reciben un salario de 3.300 dólares, según Galeano. "Nuestros 'análisis' le han costado al pueblo 2,2 millones de dólares al año", lamentó.

"No podemos ayudar a la Policía Nacional Civil, ni recabar información sobre las bandas de delincuentes, porque nuestra red de información consta de sólo 13 delegados para todas las provincias", explicó Galeano.

"No es mi culpa que esté así, sólo tengo (llevo) un mes en ese cargo", se justificó el jefe de la inteligencia, que llegó al puesto en sustitución de Gustavo Solano, destituido por el presidente guatemalteco, Álvaro Colom, tras descubrirse que la entidad había montado un sistema de espionaje en la propia residencia presidencial.

Solano ahora es prófugo de la justicia. Entre las principales atribuciones de la Secretaría de Inteligencia, están las de realizar análisis estratégicos y formular los escenarios que permitan identificar las amenazas internas y externas, para que el presidente pueda tomar las decisiones adecuadas.

viernes, 19 de diciembre de 2008

Como si no hubiera visto uno en su vida...

[Vía 20minutos.es]


Paris Hilton se pone a llorar y la monta por el condón de un reportero de Cuatro


Paris Hilton se pone a llorar y la monta por el condón de un reportero de Cuatro
  • La famosa ex presidiaria lloró y se enfadó con un reportero que le ofreció un condón, para dar plantón a la prensa española después.
  • Su guardaespaldas requisó la cinta y la borraron, diciéndole antes Paris al reportero: "que te den, chulito".
  • Después de comer, la ex novia de Benji Madden decidió celebrar una rueda de prensa, en la que nadie podía tocarla ni contrariarla.

Ayer, la estrella mediática Paris Hilton estuvo en Madrid promocionando una red social. Al acto estaban invitados todos los medios de comunicación, y estaban previstas entrevistas con la prensa. Sin embargo, todo se torció. Paris Hilton, la reina de la provocación, no supo entender el humor de la prensa española, después de hacerla esperar y llegar con dos horas de retraso.

En primer lugar, durante la sesión de fotos, la famosa ya hizo un desplante a los reporteros de Caiga Quien Caiga que intentaron que Paris respondiera a un test basado en un dado en el que había perritos en actitudes jocosas. La rubia heredera se dio la vuelta y le dijo a su representante "no pienso contestar estas preguntas".

Pero lo peor, el desplante inexplicable, vino después. Un reportero de Cuatro, Miguel Rabaneda, del programa Las Mañanas de Cuatro, se acercó a la estrella para preguntarle si estaba preparada para la noche madrileña. "Le pregunté si iba a salir a la noche madrileña, y me dijo que no había tenido tiempo. Le advertí que las noches de marcha en Madrid eran muy intensas, y que nunca se sabía, así que en tono de broma le ofrecí un condón" cuenta el reportero.

"Entonces se bloqueó. Momentos antes nos habíamos abrazado y había sido cordial, pero empezó a mirar a su guardaespaldas y a llorar. Intenté explicarles que sólo queríamos una frase del tipo póntelo, pónselo, pero no nos escucharon" narra el periodista. "Les dijimos que sin problemas podíamos ver la grabación y quitar lo que no les gustara, pero ellos se hicieron con la cinta, que nosotros le habíamos dado a la organización española".

Después de eso, Paris Hilton y su guardaespaldas subieron a su habitación, para inspeccionar la cinta, y antes de entrar en el ascensor, la famosa le dijo al reportero "que te den chulito". "Nos devolvieron la cinta completamente borrada", asegura el reportero, que además hace ver que la organización no les permitió permanecer en la rueda de prensa.

"Les dimos la cinta para no empeorar las cosas, y no destrozar el trabajo del resto de los compañeros que habían ido a entrevistarla" explica Miguel Rabaneda. El tema se tratará en el programa Las Mañanas de Cuatro, a partir de las 12.30 h.

Después de una hora y media aproximadamente, y tras haber aprovechado para comer, Paris se dignó regresar, y concedió una entrevista a un pequeño grupo de periodistas, para a continuación dar una rueda de prensa, eso sí, con las condiciones previas: No tocarla, no ofrecerle nada, no hacer referencia a cuestiones escabrosas de su pasado, no referirse a su ex novio...

lunes, 15 de diciembre de 2008

Los japoneses y su tiempo libre...

[Vía: ya.com]


Transformar sueños en imágenes de televisión, al alcance de la ciencia en Japón

Transformar nuestros sueños en imágenes de televisión es lo que esperan poder lograr en el futuro con su nueva técnica de análisis cerebral un grupo de investigadores japoneses, según anunciaron el jueves.

Un equipo del laboratorio japonés de neurología ATR dirigido por Yukiyasu Kamitani declaró haber logrado, "por primera vez en el mundo, recrear en imágenes el contenido de percepciones cerebrales complejas".

Sus trabajos consistieron en hacer observar una forma (una letra del alfabeto) a un individuo y reconstituirla en una pantalla analizando la actividad cerebral del sujeto. Los científicos interceptaron señales eléctricas procedentes del ojo y verificaron la concordancia entre la forma observada y la reproducida.

"Si un día llegamos a poner en imágenes las señales que atraviesan nuestras neuronas, podremos, quizás, ver en una pantalla nuestros sueños y otros pensamientos, como si fuesen películas o programas de televisión", aseguraron.

Además, consideran que ese proceso debería permitir el desarrollo de nuevas formas de interacción entre el hombre y las máquinas, estableciendo un conjunto de relaciones entre una combinación de movimientos y un motivo de señales cerebrales.

La técnica empleada podría también dar la posibilidad a arquitectos y otros creadores de mostrar los proyectos que tienen en la cabeza incluso si no encuentran las palabras para explicarlos o no saben dibujarlos.

Para lograr ese dispositivo de conversión de señales cerebrales en imágenes, el equipo de Kamitani desarrolló una especie de decodificador de las variaciones cerebrales a través de la asociación de un tipo de señal y de una forma básica conocida. A continuación combinaron varias parejas de señal-forma para recrear imágenes complejas.

Por el momento, el sistema es limitado y no permite reproducir todas las percepciones. Exige, en primer lugar, realizar un panel de correspondencia entre formas y señales para cada individuo.

sábado, 13 de diciembre de 2008

Pulsa "-->" y a continuación "X"

[Vía: sport.es]


Ronaldinho falló un penalty por culpa de la 'Play'

El portero del Palermo, Marco Amelia, tuvo una destacadísima actuación ante el equipo de Ancelotti (3-1). Pero la pena máxima detenida a 'Ronnie', con empate a cero en el marcador, fue clave

Ronaldinho no acertó en su primera oportunidad desde el punto de penalty

Ronaldinho no acertó en su primera oportunidad desde el punto de penalty.

La sorpresa vino cuando el cancerbero del Palermo aseguró que la famosa videoconsola fue la culpable de su acierto. "Ha sido como echar una partida contra él. Hizo exactamente el mismo movimiento de aproximación al balón que en la consola. La verdad es que ha sido un poco extraño", afirmó Marco Amelia en 'Sky'.

Sin embargo, en el penalty que se produjo en la segunda mitad, Ronaldinho sí acertó y Marco Amelia no pudo hacer nada para detenerlo.

viernes, 12 de diciembre de 2008

Un perro socorre a otro malherido

[Vía: 20minutos.es]




Sucedió en una autopista de Santiago de Chile. Un perro que trataba de cruzar la vía fue atropellado por un coche quedando malherido.

Otro perro se apercibió de su presencia, y sorteando el tráfico llegó hasta el animal moribundo y lo arrastró con la boca hacia un lugar seguro en el arcén de la carretera.

Debido al fuerte instinto de estos animales, y a su comportamiento social tendente a crear fuertes vínculos con otros individuos de la manada, el hecho de que un perro se 'juegue la vida' para rescatar a otro, no es ni mucho menos fortuito. Como escribe Claudio Gerzovich en El perro como especie social, "el grado de dependencia social entre estos animales es muy alto".

jueves, 11 de diciembre de 2008

Yeah baby, yeah!

[Vía: ya.com]

Se queda sorda por besarse con su novio

-Una joven China ha perdido toda su capacidad auditiva tras besarse con demasiada pasión con su novio, según el diario 'Nanfang Daily'.

Todo ocurrió cuando la joven, de Zhuhai, se besaba de forma "demasiado ardiente" con su novio. El apasionado beso provocó la rotura de su tímpano izquierdo. La pareja explicó que habían oído un sonido repentino, como un 'puff' mientras se estaban besando, y que a partir de ese momento la chica dejó de oír.

Los jóvenes tardaron más de una hora en decidirse en ir al hospital y solo fueron después de comprobar que la chica era totalmente incapaz de oír a su novio ni las bocinas de los coches.

Según explicó al diario el médico otorrino que trató a la paciente, a pesar de que resulta poco frecuente perder la capacidad auditiva por este motivo, fisiológicamente, si los besos son excesivamente apasionados puede ocurrir, ya que puede producirse un cambio de presión en el oído interno que termine causando la rotura del tímpano.

El truco está en no dar besos "demasiado ardientes, demasiado largos y que exijan un esfuerzo excesivo, ya que pueden causar efectos secundarios". Besar, según concluye el periódico, también es una cuestión que exige moderación. El problema, no obstante, puede corregirse tras un par de meses de tratamiento.

martes, 9 de diciembre de 2008

Expediente X en el fútbol

La ciencia aún no ha logrado explicar la estupidez del árbitro:

[Vía: marca.com]


EL ÁRBITRO SEÑALÓ UNO DE LOS PENALTIS MÁS RAROS QUE SE HAN VISTO NUNCA

El mayor 'piscinazo' de la historia del fútbol

¿Es el mayor ‘piscinazo’ de la historia del fútbol? Probablemente sí.

El partido entre el Atlético Junior y el América de Calí (1-1) pasará a la posteridad por uno de los penaltis más extraños que se han visto nunca en un campo de fútbol.

El árbitro José Niño señaló la pena máxima después de que un jugador del Atlético Junior se dejase caer en el área... sin nadie en un par de metros a la redonda Hayder Palacio ejecutó el penalti para adelantar al Atlético Junior y ya en la segunda parte Paulo Arango hizo justicia y puso el 1-1 en el luminoso.

domingo, 7 de diciembre de 2008

Best Scenes Ever: "I'm glad it's you"

En 2002, el director de American Beauty, Sam Mendes, adaptó al cine la novela gráfica "Road to Perdition", haciendo algo que pocas personas han logrado hacer: crear un clásico instantáneo. Su cuidado guión, sus fantásticas interpretaciones, su absolutamente bellísima fotografía y su delicada dirección hacen de Camino a la Perdición un referente en la utópica búsqueda de la película perfecta.


ROAD TO PERDITION (2002)


ARGUMENTO

Mike Sullivan (Tom Hanks) trabaja para el Señor John Rooney (Paul Newman). Esto es todo lo que sabe el pequeño Mike Junior sobre la vida laboral de su padre, sin sospechar que en realidad su trabajo consiste en ser el mejor matón de la mafia irlandesa. Una noche, el niño decide descubrir a que se dedica en realidad y sigue a escondidas a su padre en una de sus salidad nocturnas. Entonces es testigo de un asesinato a sangre fría por parte de Connor (soberbio Daniel Craig, en su etapa pre-007), el hijo del Señor Rooney.
Por miedo a que el niño hable, Connor ejecuta a la familia de Sullivan, pero padre e hijo logran escapar, convirtiendose en fugitivos de la gente a la que servían y jurando al mismo tiempo vengarse de los asesinatos de su esposa y su otro hijo. Entonces surge la figura de Harlen Maguire (Jude Law), un despiadado asesino a sueldo que perseguirá a los dos Sullivan's.


LAS ESCENAS

(Alerta de Spoliers)
Para homenajear esta película, he elegido un par de momentos de entre los muchos que hay.
En el primero, una suave melodía de piano muestra la conexión paternofilial que hay entre los personajes de Hanks y Newman, en contraste a los celos que despierta dicha conexión en el rostro de Craig.
Por cierto, la canción que los dos actores tocan fue compuesta por el mismísimo John Williams sólo para este momentazo. El resto de la banda sonora (que podréis disfrutar en todo su esplendor en la segunda escena) está compuesta por el minimalista Thomas Newman.

BECAUSE IT'S ALL SO FUCKING HYSTERICAL



La segunda escena que muestro es el momento más mítico de la película y uno de los más perfectos de la historia del cine. Sullivan ha comprendido que para poder llevar a cabo su venganza hacia Connor, tiene que pasar por encima de John Rooney, el hombre que fue un padre para él y un abuelo para sus hijos.
El momento en cuestión es una ensoñación, una irrealidad. Toda la película está plagada de simbolismos y recursos visuales (El agua en los momentos en los que muere alguien - similar a las famosas naranjas de la trilogía de El Padrino -, los juegos de luces que se concentran en personajes claves olvidando al resto, etc) y esta secuencia no iba a ser menos.

I'M GLAD IT'S YOU


El narrador de la película es el hijo de Mike, pero no es una narrador omnisciente. Solamente podemos ver con claridad aquellos momentos en los que el niño está presente. El resto está en sombras y tinieblas; son suposiciones e invenciones para intentar rellenar las lagunas de información. En esta escena, el niño se ha quedado en el hotel solo, pero sabe que su padre ha ido a matar al Sr. Rooney, por lo que son los dos únicos personajes que se nos muestran iluminados. Los demás se quedan en sombras o en penumbras y nunca los vemos claramente. Casi forman parte del atrezzo. La misma calle es casi un fantasma, un lugar estandar, poco definido y decorado, irrelevante, como lo son las personas que se asoman por las ventanas. Los únicos elementos importantes son Sullivan y Rooney; lo único que Mike Jr. sabe con total seguridad que fue real.

jueves, 4 de diciembre de 2008

Un municipio británico proporcionará chancletas a las mujeres borrachas

[Vía: canarias7.es]

Un municipio del suroeste de Inglaterra proporcionará gratuitamente chancletas a las mujeres demasiado borrachas como para volver a casa con tacones altos.

Se trata de una iniciativa conjunta de la policía de los condados de Devon y Cornualles, el municipio de Torbay, el servicio de ambulancias y bomberos y la autoridad educativa local, informa hoy el diario 'The Times'.

Su objetivo es reducir en todo lo posible la cifra de mujeres lesionadas mientras duren las celebraciones de las fiestas navideñas, normalmente regadas con abundante alcohol.

La policía llevará bolsas con chancletas y las pondrá a disposición de todas aquellas mujeres a las que vea caminar zigzagueando.

Las chancletas, que llevan impresos mensajes sobre la conveniencia de no abusar del alcohol, estarán también disponibles en diversos puntos de la ciudad.

El grupo de presión "Taxpayer's Alliance" (Alianza de los Contribuyentes), calificó el plan, que ha costado el equivalente de 36.000 euros, de "estúpido despilfarro del dinero público".

El dinero presupuestado para esa iniciativa cubrirá también el costo de los preservativos y equipos de alarma para casos de violación que se entregarán también gratuitamente.

Según el periódico, en una discoteca para menores de dieciséis años, el llamado Club 2k, de la localidad de Penzance, se han introducido alcoholímetros por la preocupación de que los menores ingieran bebidas alcohólicas.

Si cualquiera de los alrededor de 300 menores que acuden al baile de los viernes, muchas veces acompañados de sus padres, da positivo en la prueba de alcohol, inmediatamente se verá expulsado del local.

martes, 2 de diciembre de 2008

El colmo del absurdo

[Vía: laopiniondemalaga.es]


Una mujer de 73 años muere en Antequera atrapada en una cama abatible






Los familiares no descartan denunciar al comercio donde la víctima adquirió el mobiliario. La alarma saltó entre los vecinos al no verla en toda la mañana

ROSANA CHICÓN. ANTEQUERA Una vecina de la pedanía antequerana de Bobadilla Estación ha sido encontrada muerta en su propia casa, atrapada en una cama abatible que había comprado recientemente. Según apuntaron los familiares, un fallo en el montaje del mobiliario fue el causante del fallecimiento.
La víctima, de 73 años, cuyas iniciales son P. H., había comprado la cama días antes para que la utilizaran sus dos hijos cuando fueran a visitarla, ya que viven fuera del anejo, uno en Antequera y otro en Castellón. "Nos extrañamos al no verla comprando el pan, como cada mañana", explicó la cuñada de la víctima, Josefa Zambrana.
Los hijos comenzaron a preocuparse después de llamar varias veces al domicilio sin obtener respuesta. "No cogía el teléfono y no la veían por ningún lado, así que esa misma mañana fuimos directos a la casa", detalló desconsolado el hijo que vive en Antequera.
La sorpresa llegó cuando entraron en el domicilio a buscar a su madre y no la encontraron en ninguna de las habitaciones, aunque todo estaba intacto. "Sus gafas, sus anillos y el mando de la teleasistencia estaban donde siempre, incluso llegamos a abrir un poco la cama abatible, pero no nos imaginábamos que podría estar allí", apuntó la cuñada.
Sobre las cuatro de la tarde, una de las nueras de la fallecida decidió volver a la casa a buscarla y la encontró atrapada entre el colchón y la pared del mueble. "Llamamos rápidamente a la policía, no nos lo podíamos creer, habíamos estado esa misma mañana en la casa y no la habíamos visto", especificó Josefa.
El cadáver fue trasladado al Palacio de la Justicia, en Málaga, donde se le realizó la autopsia. No obstante, los hijos de la víctima aún están a la espera de los resultados para conocer los motivos y la hora de la muerte. "Lo único que sabemos es que a mi madre le tendieron una trampa mortal y vamos a pedir responsabilidades", afirmó uno de los sucesores.
La familia de la fallecida informó a este periódico de que emprenderá medidas legales contra la empresa en la que adquirieron la cama abatible ya que consideran que hubo un fallo por parte de ésta tanto en la fabricación como en el montaje del mobiliario. "Fue rápido y chapucero, además de no contar con el sistema de seguridad adecuado y no probarla al terminar", detalló el hijo.
La muerte se produjo en la noche del pasado martes, no obstante, los familiares no dieron con la fallecida hasta el día siguiente, a las cuatro de la tarde. Entre las hipótesis sobre la causa de la muerte, se baraja que la mujer pudiera haber muerto por asfixia ya que el cuerpo quedó atrapado. Esta vecina, natal de la pedanía antequerana de Bobadilla Estación, fue enterrada el jueves en la Iglesia Nuestra Señora de los Dolores, donde familiares y vecinos le dieron su último adiós.

lunes, 1 de diciembre de 2008

"guauguauguauguauguaugalletaguau"

[Vía: tendencias21.net]

Desarrollan un software que entiende el ladrido de los perros

Es capaz de clasificarlos en función de diferentes situaciones vividas por el animal


Un grupo de informáticos de la Universidad EL de Budapest, en Hungría, ha creado un algoritmo que tiene la capacidad de “entender”, clasificar e identificar los ladridos de un perro. Según sus creadores, este desarrollo tiene la particularidad de que hace su trabajo incluso en diferentes contextos, como “juego”, “lucha” o “paseo”. Los resultados de este estudio sugieren que los perros emiten diferentes sonidos acústicos en función de su estado emocional. Este sistema es capaz, asimismo, de reconocer el ladrido individual de un perro en concreto, lo cual es incapaz de hacer el ser humano. El software abre nuevas perspectivas y caminos en el estudio del comportamiento animal. Por Raúl Morales.



Desarrollan un software que entiende el ladrido de los perros
Un nuevo programa informático desarrollado por el profesor Csaba Molnár, de la Universidad Eötvos Loránd, en Budapest, se ha convertido en la herramienta más precisa para estudiar las comunicaciones acústicas entre animales, ha informado Reuters.

Uno de los campos más apasionantes de la informática y la computación es la comunicación entre el ser humano y la máquina, explorar diferentes posibilidades para que un ordenador consiga entendernos cuando le hablamos. Se han dado ya importantes pasos en esta línea de investigación. Sorprende, sin embargo, que los informáticos hayan fijado su punto de mira en otro tipo de comunicación: entre perro y máquina.

Los resultados de la investigación, que han sido presentados en la revista “Animal Cognition”, sugieren que los perros tienen diferentes sonidos acústicos en función de su estado emocional.

Según Molnár y sus colegas, sus investigaciones han demostrado que el trozo de software que han desarrollado es capaz de clasificar los ladridos de un perro en función de situaciones diferentes e incluso identificar el ladrido de un perro en concreto, algo que un ser humano es casi incapaz de hacer.

Detrás de este proyecto está el interés de Molnár de experimentar la habilidad de un algoritmo informático para identificar y diferenciar sonidos acústicos del ladrido de los perros, así como clasificarlos en función de diferentes contextos y animales individuales.

Para ello, el software ha analizado más de 6.000 ladridos en seis situaciones diferentes: “extraño”, “lucha”, “paseo”, “pelota”, “juego” y “a solas”. Los ladridos fueron grabados antes de ser transferidos a un ordenador, donde fueron digitalizados. Los ladridos individuales fueron codificados, clasificados y evaluados.

Grado de acierto

En el primer experimento, en el que se buscaba una clasificación según las situaciones, el software fue capaz de reconocer el ladrido en el 43% de los casos. Los mejores índices de reconocimiento fueron en la situación de “lucha” y “extraño”. Por el contrario, los índices más bajos fueron para el contexto de “juego”.

Estos datos sugieren que los diferentes estados motivacionales de los perros en contextos sumisos, amistosos o agresivos resultarían de ladridos acústicamente diferentes.

En el segundo experimento, se trataba de ver en qué grado el algoritmo era capaz de saber qué perro realizaba qué ladrido. En este caso, clasificó correctamente los ladridos en el 52% de los casos.

Se trata de un porcentaje altísimo si pensamos que el ser humano es totalmente incapaz de discriminar entre el ladrido de los perros. Queda claro, pues, que hay matices en los ladridos que nuestro oído no puede apreciar.

Según sus autores, este trabajo puede ser de gran ayuda para los dueños y los adiestradores de perros. “Si podemos encontrar la característica acústica de un perro que representa cierta emoción, podemos tener información muy valiosa respecto al bienestar del animal.”, comenta Molnár en declaraciones al Daily Telegraph.

Otras aplicaciones

Siendo muy optimistas, este proyecto podría derivar en el desarrollo de un ordenador (comercializable) que sea capaz de “entender” los ladridos, de tal modo que podría ser un interlocutor entre el animal y sus dueños cuando, por ejemplo, nuestra casa está siendo asaltada por un desconocido.

Lo que ha dejado claro es proyecto es que el uso de algoritmos en ordenadores avanzados para clasificar y analizar los sonidos de animales abre nuevas perspectivas para la comprensión de la comunicación animal.

De manera inequívoca, los prometedores resultados sugieren que la informática tiene que ser seriamente considerada en le campo de la etología (rama de la biología que estudia el comportamiento de los animales).

Molnár y su equipo tienen previsto, en un siguiente paso, comparar la manera en que los perros se comunican, analizando los ladridos de diferentes razas para llegar a conocer de qué forma han ido variando respecto a, por ejemplo, los lobos, según estos animales han sido domesticados por el ser humano.